|
Addgene inc
luciferase Luciferase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/luciferase/product/Addgene inc Average 93 stars, based on 1 article reviews
luciferase - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
non targeting control Non Targeting Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/non targeting control/product/Addgene inc Average 94 stars, based on 1 article reviews
non targeting control - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
|
Addgene inc
article 802169 commonly used phluorin Article 802169 Commonly Used Phluorin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/article 802169 commonly used phluorin/product/Addgene inc Average 90 stars, based on 1 article reviews
article 802169 commonly used phluorin - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Addgene inc
non targeting control grna Non Targeting Control Grna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/non targeting control grna/product/Addgene inc Average 94 stars, based on 1 article reviews
non targeting control grna - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
|
Addgene inc
sgrna vector cloning 363 single guide rna sgrna sequences Sgrna Vector Cloning 363 Single Guide Rna Sgrna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sgrna vector cloning 363 single guide rna sgrna sequences/product/Addgene inc Average 94 stars, based on 1 article reviews
sgrna vector cloning 363 single guide rna sgrna sequences - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
|
Synthego Inc
paper custom non targeting control ntc grna gcacuaccagagcuaacuca synthego nüssing Paper Custom Non Targeting Control Ntc Grna Gcacuaccagagcuaacuca Synthego Nüssing, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/paper custom non targeting control ntc grna gcacuaccagagcuaacuca synthego nüssing/product/Synthego Inc Average 86 stars, based on 1 article reviews
paper custom non targeting control ntc grna gcacuaccagagcuaacuca synthego nüssing - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Addgene inc
non target control Non Target Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/non target control/product/Addgene inc Average 92 stars, based on 1 article reviews
non target control - by Bioz Stars,
2026-05
92/100 stars
|
Buy from Supplier |
|
Addgene inc
non targeting sgrna Non Targeting Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/non targeting sgrna/product/Addgene inc Average 90 stars, based on 1 article reviews
non targeting sgrna - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Addgene inc
non targeting guide rna Non Targeting Guide Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/non targeting guide rna/product/Addgene inc Average 91 stars, based on 1 article reviews
non targeting guide rna - by Bioz Stars,
2026-05
91/100 stars
|
Buy from Supplier |
|
Addgene inc
non targeting control sgrna ![]() Non Targeting Control Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/non targeting control sgrna/product/Addgene inc Average 93 stars, based on 1 article reviews
non targeting control sgrna - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: bioRxiv
Article Title: SETD2 safeguards the genome against isochromosome formation
doi: 10.1101/2022.10.25.513694
Figure Lengend Snippet: a, Images of wild-type, heterozygous or homozygous deletion of Setd2 have lagging (blue arrows) and bridging (orange arrows) chromosomes during anaphase. MEFs with no, one or two floxed alleles of Setd2 ( Wild-type/Wt , Flox/Wt , Flox/Flox , respectively) were either treated with Vehicle (EtOH, control in top panels) or 4-OHT (excise floxed alleles of Setd2 , bottom panels) for three days, fixed and counterstained with Hoechst (grey). Scale bars are 5μm. b, Quantification of chromosome segregation errors during anaphase and early telophase in control (vehicle treated) or 4-OHT treated MEFs described in a . n=198 wt/wt vehicle, n=215 wt/wt 4-OHT, n=298 fl/wt vehicle, n=227 fl/wt 4-OHT, n=258 fl/fl Vehicle, n=225 fl/fl 4-OHT cells across 2 ( wt/wt ), 4 ( fl/wt ), and 3 ( fl/fl ) biological replicates. P-values derived from unpaired t-test of normal cell values between treatment groups for each genotype. c, Images of anaphases in control (untreated) or doxycycline-treated HeLa cells expressing tetracycline-inducible Cas9 (TetOn-Cas9) and single-guide RNA (sgRNA) that are Non-targeting (NT) or specific for SETD2 . Cells are counterstained with Hoechst (grey). Lagging (blue) and bridging (orange) chromosomes occur in cells lacking SETD2. Scale bars are 5μm. d, Quantification of chromosome segregation errors during anaphase and early telophase in cells described in c . n=183 sgNT control, n=190 sgNT dox., n=198 sgSETD2.1 control, n=240 sgSETD2.1 dox., n=187 sgSETD2.2 control, n=246 sgSETD2.2 dox. cells across 3 biological replicates. P-values derived from unpaired t-test of normal cell values between treatment groups for each sgRNA background. e, Image of Setd2 fl/fl MEFs treated with 4-OHT (at left), showing nuclear defects that occur in interphase after three days treatment. Scale bars are 50μm (top images) and 5μm (greyscale images at bottom). f, Quantifications of nuclear phenotypes from images described in e for Setd2 MEFs. n=450 wt/wt vehicle, n=617 wt/wt 4-OHT, n=650 fl/wt vehicle, n=509 fl/wt 4-OHT, n=736 fl/fl Vehicle, n=687 fl/fl 4-OHT cells across 3 biological replicates. P-values derived from unpaired t-test of normal cell values between treatment groups each genotype. g, Quantification of interphase bridges observed in cell images described in e . P-values derived from unpaired t-test of normal cell values between treatment groups each genotype. Error bars are standard deviation (s.d.).
Article Snippet: HeLa TetOn-Cas9 cells were transduced with 8mg/mL polybrene (Millipore Sigma, TR-1003) and viral supernatant for guides targeting SETD2 or
Techniques: Control, Derivative Assay, Expressing, Standard Deviation